cpn60 (cpn60) allele sequence: id-190

Contig position

sequence bin id
16772
contig length
39799
start
35568
end
35870
length
303
orientation
reverse
complete
yes
Options

Sequence

GGTTAAAGAA GTTGCTTCTA AAACCAATGA TGTGGCTGGC GACGGCACAA CCACCGCAAC CGTGTTGGCG CAAGCGATTG TTGCTGAAGG CATGAAATAC GTTACCGCAG GCATGAACCC TACCGATTTG AAACGCGGTA TTGACAAAGC AGTGGCGGCT TTGGTTGGCG AATTGGCAAA CATCGCGAAA CCTTGCGAAA CATACGAGCA AATCGCTCAA GTGGGCGCGA TTTCTGCGAA CTCTGACGAG CAAGTTGGCA AAATCATTGC AGACGCGATG CAAGAAGTCG GCAAAGAGGG CGTGATTACC GTTGAAGACG GCAAATCATT GGAAAACGAG TTGGAAGTGG TTAAAGGTAT GCAATTTGAC CGTGGCTACT TGTCGCCTTA TTTCGTGAAT GATTTGGAAA AACAAATCGC TGGTTTGGAC AGCCCATTTG TGTTGTTGTT TGACAAAAAA ATCAGCAATA TCCGTGATTT GTTGCCTGTT TTGGAACAAG TGG

Translation


          G  *  R  S  C  F  *  N  Q  *  C  G  W  R  R  H  N  H  R  N  R  V  G  A  S  D  C  C  *  R  H  E  I  R   F1
           V  K  E  V  A  S  K  T  N  D  V  A  G  D  G  T  T  T  A  T  V  L  A  Q  A  I  V  A  E  G  M  K  Y     F2
            L  K  K  L  L  L  K  P  M  M  W  L  A  T  A  Q  P  P  Q  P  C  W  R  K  R  L  L  L  K  A  *  N  T    F3
        1 GGTTAAAGAAGTTGCTTCTAAAACCAATGATGTGGCTGGCGACGGCACAACCACCGCAACCGTGTTGGCGCAAGCGATTGTTGCTGAAGGCATGAAATAC 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            Y  R  R  H  E  P  Y  R  F  E  T  R  Y  *  Q  S  S  G  G  F  G  W  R  I  G  K  H  R  E  T  L  R  N    F1
          V  T  A  G  M  N  P  T  D  L  K  R  G  I  D  K  A  V  A  A  L  V  G  E  L  A  N  I  A  K  P  C  E  T   F2
           L  P  Q  A  *  T  L  P  I  *  N  A  V  L  T  K  Q  W  R  L  W  L  A  N  W  Q  T  S  R  N  L  A  K     F3
      101 GTTACCGCAGGCATGAACCCTACCGATTTGAAACGCGGTATTGACAAAGCAGTGGCGGCTTTGGTTGGCGAATTGGCAAACATCGCGAAACCTTGCGAAA 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           I  R  A  N  R  S  S  G  R  D  F  C  E  L  *  R  A  S  W  Q  N  H  C  R  R  D  A  R  S  R  Q  R  G     F1
            Y  E  Q  I  A  Q  V  G  A  I  S  A  N  S  D  E  Q  V  G  K  I  I  A  D  A  M  Q  E  V  G  K  E  G    F2
          H  T  S  K  S  L  K  W  A  R  F  L  R  T  L  T  S  K  L  A  K  S  L  Q  T  R  C  K  K  S  A  K  R  A   F3
      201 CATACGAGCAAATCGCTCAAGTGGGCGCGATTTCTGCGAACTCTGACGAGCAAGTTGGCAAAATCATTGCAGACGCGATGCAAGAAGTCGGCAAAGAGGG 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          R  D  Y  R  *  R  R  Q  I  I  G  K  R  V  G  S  G  *  R  Y  A  I  *  P  W  L  L  V  A  L  F  R  E  *   F1
           V  I  T  V  E  D  G  K  S  L  E  N  E  L  E  V  V  K  G  M  Q  F  D  R  G  Y  L  S  P  Y  F  V  N     F2
            *  L  P  L  K  T  A  N  H  W  K  T  S  W  K  W  L  K  V  C  N  L  T  V  A  T  C  R  L  I  S  *  M    F3
      301 CGTGATTACCGTTGAAGACGGCAAATCATTGGAAAACGAGTTGGAAGTGGTTAAAGGTATGCAATTTGACCGTGGCTACTTGTCGCCTTATTTCGTGAAT 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            F  G  K  T  N  R  W  F  G  Q  P  I  C  V  V  V  *  Q  K  N  Q  Q  Y  P  *  F  V  A  C  F  G  T  S    F1
          D  L  E  K  Q  I  A  G  L  D  S  P  F  V  L  L  F  D  K  K  I  S  N  I  R  D  L  L  P  V  L  E  Q  V   F2
           I  W  K  N  K  S  L  V  W  T  A  H  L  C  C  C  L  T  K  K  S  A  I  S  V  I  C  C  L  F  W  N  K     F3
      401 GATTTGGAAAAACAAATCGCTGGTTTGGACAGCCCATTTGTGTTGTTGTTTGACAAAAAAATCAGCAATATCCGTGATTTGTTGCCTGTTTTGGAACAAG 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           G                                                                                                     F1
            X                                                                                                    F2
          W                                                                                                      F3
      501 TGG 503
          ---